ОРИГИНАЛЬНЫЕ ИССЛЕДОВАНИЯ / НАУЧНАЯ СТАТЬЯ ОБ ИССЛЕДОВАНИИ ДИГИДРОКВЕРЦЕТИНА В ТЕРАПИИ ОСТЕОПОРОЗА

https://doi.org/10.3389/fphar.2018.01286

Конг Цай,  Чанюй Лю,  Лимин Чжао, Хуэй Лю ,  Вэйцзин Ли, Ханьфэн Гуань ,  Либо Чжао, Цзюнь Сяо 

Отделение ортопедической хирургии, больница Тунцзи, медицинский колледж Тунцзи, Университет науки и технологии Хуажонг, Ухань, Китай

Остеопороз - широко распространенное заболевание, которое считается связанным с хроническим системным воспалением и окислительным стрессом. Таксифолин является природным флавоноидом и обладает многими лечебными свойствами, включая антиоксидантные и противовоспалительные. 

Подтверждено, что флавоноиды борются с остеопорозом и способствуют укреплению здоровья костной ткани. Поэтому целью этого исследования было изучение влияния таксифолина на образование и функцию остеокластов. Остеокласты – это клетки, призванные разрушать отжившую костную ткань, возвращая кальций в свободном виде в плазму крови.

В этом исследовании авторы изучили влияние таксифолина на остеокласты, используя исследования как in vitro (в лаборатории) так и in vivo (в клинической практике) . Таксифолин/дигидрокверцетин подавлял активацию ядерного фактора -κB, C-Fos и митоген-активируемой протеинкиназы, а также уменьшал экспрессию остеокласт-специфических генов, таких, как Trap, Mmp-9, Cathepsin K, C-Fos, Nfatc1, и Rank.

Таксифолин/дигидрокверцетин  также предотвращал продукцию активных форм кислорода (АФК) после стимуляции. Кроме того, таксифолин уменьшал вызванную экспериментальной овариэктомией (удаления яичников) потерю костной ткани путем подавления активности остеокластов и снижения сывороточных уровней фактора некроза опухоли-α, интерлейкина-1β, интерлейкина-6 и рецептора-активатора лиганда ядерного фактора -κB (RANKL) в экспериментах на животных . 

Результаты показали, что таксифолин/дигидрокверцетин  подавляет остеокластогенез посредством регуляции модуляции нескольких сигнальных путей RANKL. Следовательно, таксифолин может рассматриваться как потенциальное альтернативное терапевтическое средство для лечения заболеваний, связанных с остеопорозом и гиперфункцией остеокластов.

Вступление

Костный гомеостаз (постоянство состава) поддерживается за счет взаимных, но противоположно направленных функций:

  • постоянного разрушения - остеокластической резорбции кости;
  • постоянного формирования кости остеобластами. 

Дисбаланс, вызванный чрезмерной резорбцией кости, приведет к различным остеопатическим заболеваниям, таким как остеопороз и болезнь Педжета . Остеокласты являются основным типом гигантских поликарионов (многоядерных клеток), которые в развитии отличились от клеток-предшественников моноцитарно-макрофагальной линии. Это различие вызвано стимуляцией двумя факторами:

  • макрофагально-колониестимулирующим фактором (M-CSF). M-CSF является критическим фактором для пролиферации и выживания предшественника остеокласта;
  • активатором рецептора лиганда NF-κB (RANK) (RANKL).

Связывание RANKL и RANK активирует фактор 6, связанный с рецептором фактора некроза опухоли (TRAF6). Впоследствии TRAF6 приводит к активации передачи сигналов NF-κB, MAPK (ERK, JNK и p38), PI3K / AKT, C-Fos, белка-активатора 1 (AP-1) и ядерного фактора и активатора транскрипции (NFATc1).

Считается, что остеопороз связан с хроническим слабым системным воспалением и окислительным повреждением (оксидантным стрессом в русскоязычной литературе, прим. пер). Повышенная продукция провоспалительных цитокинов, таких как TNF-α, IL-6 и IL-1β, связана с остеокластической резорбцией кости ( Mundy, 2007). Кроме того, активные формы кислорода (ROS), генерируемые после связывания RANKL с его рецептором, также способствуют остеокластогенезу через сигнальные пути RANK, включая AKT, MAPK и NF-κB ( Lee et al., 2005 ; Kim et al., 2006 ; Sasaki et al., 2009 ). 

АФК может выступать в качестве внутриклеточных вторичных переносчиков в сигнальных путях остеокластогенеза, индуцированных RANKL, а дифференцировка остеокластов может быть ингибирована путем удаления АФК ( Lee et al., 2005 ; Chen et al., 2016 ). Все эти пути, упомянутые выше, играют существенную роль в остеокластогенезе и функции остеокластов, стимулируя образование остеокластов и, следовательно, резорбцию кости. Активация всех этих путей приведет к остеопорозу.

О таксифолине

Таксифолин/дигидрокверцетин  является распространенным флавоноидом. Это группа соединений, широко распространенных в растениях. Также они применяются в качестве ингредиентов рациона человека, и они были очень популярны из-за их многих полезных для здоровья и профилактических свойств ( Winkel-Shirley, 2001 ; Salaritabar et al. ., 2017 ). 

Появляются новые данные, свидетельствующие о том, что таксифолин/дигидрокверцетин  оказывает различное действие, включая антиоксидантную, противовоспалительную, противовирусную, антибактериальную, противоопухолевую и нейропротекторную активность ( Dok-Go et al., 2003 ; Wang et al., 2006 ; Manigandan et al., 2015 ; Чжао и др., 2015 ; Галочкина и др., 2016 ; Биджак, 2017). 

Таксифолин/дигидрокверцетин  может уменьшать окислительное повреждение, модулируя сигнальный путь NF-κB ( Wang et al., 2006 ; Kim et al., 2017 ). Таксифолин/дигидрокверцетин  является эффективным средством химиопрофилактики. Он способен модулировать воспаление, поскольку он ингибирует NF-κB путем снижения уровня регуляторных метаболитов, таких как TNF-α.

Недавно сообщалось, что таксифолин/дигидрокверцетин  стимулирует дифференцировку остеобластов в мезенхимальных стволовых клетках костного мозга путем ингибирования транслокации NF-κB в ядре ( Wang et al., 2017 ). Таксифолин/дигидрокверцетин  также может стимулировать дифференцировку остеобластов в клетках MC3T3-E1 и ингибировать остеокластогенез в клетках RAW264.7 ( Satue et al., 2013 ). 

Однако вопросы о том, предотвращает ли таксифолин/дигидрокверцетин  потерю костной массы у мышей с остеопенией, и путь, по которому таксифолин ингибирует остеокластогенез, остаются открытыми. В этом исследовании мы исследуем влияния и основной механизм таксифолина/дигидрокверцетин  на остеокластогенез in vitro и остеопороз, вызванный овариэктомией in vivo.

Материалы и методы

Были использованы следующие реактивы:

  • таксифолин/дигидрокверцетин  (чистота ВЭЖХ ≥ 98%) был приобретен у Sigma-Aldrich (Шанхай, Китай);
  • рекомбинантный растворимый человеческий M-CSF и мышиный рецептор-активатор ядерного фактора -κB-лиганда (RANKL) были получены от PeproTech (Rocky Hill, NJ, United States);
  • набор для анализа пролиферации и цитотоксичности клеток МТТ был приобретен у Boster (Ухань, Китай);
  • следующие антитела были приобретены у Cell Signaling Technology (Беверли, Массачусетс, США): ERK (# 9102), фосфо-ERK (# 4377), JNK (# 9258), фосфо-JNK (# 4668), P38 (# 8690). ), фосфо-P38 (# 4511), IKKβ (# 8943), фосфо-IKKα / β (# 2697), P65 (# 8242), фосфо-P65 (# 3033), IκB-α (# 4812), фосфо- IκB-α (# 2859), NFATc1 (# 8032) и RANK (# 4845);
  • аnti-C-Fos был приобретен у Abcam (Кембридж, Массачусетс, США);
  • антитела против катепсина K, MMP-9 и TRAP были получены от Proteintech Group (Wuhan, Hubei, Китай);
  • зонд NF-κB и AP-1 был приобретен у Beyotime (Шанхай, Китай);
  • набор для окрашивания TRAP и все другие реагенты были приобретены у Sigma-Aldrich.

Животные и экспериментальный дизайн

Четырехмесячные самки мышей C57BL / 6 (21 ± 1 г) были приобретены в Центре экспериментальных животных Медицинского колледжа Тунцзи (Ухань, Китай) и использовались для ложной или двусторонней операции овариэктомии (OVX). 

Все процедуры были одобрены Комитетом по этике экспериментов на животных Медицинского колледжа Тунцзи, Хуачжунский университет науки и технологии (Ухань, Китай). Всех мышей содержали в учреждении по уходу за животными Медицинского колледжа Тунцзи при 25 ° С с 12-часовыми циклами свет / темнота, и им был предоставлен свободный доступ к нормальным мышам и пище. Они были случайным образом распределены на три группы ( n = 12 на группу):

  • группа, получавшая ложное лечение,
  • мыши с овариэктомией (OVX), получавшие физиологический раствор,
  • мыши OVX, получавшие таксифолин (50 мг / кг / день), растворенный в физиологическом растворе ( Sun) и др., 2014). 

Ложная операция была выполнена путем выявления (выведения и идентификации) двусторонних яичников, без нарушения их функции, а овариэктомия была выполнена путем удаления двусторонних яичников, оба разреза были сделаны с помощью дорсального доступа. После процедуры мышам давали возможность восстановиться в течение 1 дня, затем мышам внутрибрюшинно вводили нормальный физиологический раствор или таксифолин шесть раз в неделю в течение 6 недель. После 6 недель вмешательства мышей умерщвляли для последующих экспериментов, мы измеряли влажную массу матки для подтверждения успеха овариэктомии.

Микрокомпьютерный томографический анализ

После удаления мягких тканей на дистальном отделе бедренной кости мышей была выполнена микрокомпьютерная томография (μКT) (µ-CT50 Scanco Medical, Бассерсдорф, Швейцария). Сканирование производилось при напряжении источника 80 кВ и токе источника 80 мкА с размером вокселя 10 мкм. 

Структурные параметры кости:

  • минеральная плотность кости (BMD),
  • объем кости / объем ткани (BV / TV),
  • трабекулярное число (Tb. N.),
  •  трабекулярная толщина (Tb. Th.)
  • трабекулярное разделение (Tb. Sp.).

Все они были количественно проанализированы с помощью встроенного программного обеспечения μКT. Срезы трехмерного изображения костной структуры были реконструированы с использованием встроенного программного обеспечения. Номенклатура и сокращения параметров соответствуют рекомендациям Американского общества исследований костей и минералов.

Гистологический анализ костей

Образцы бедренной кости декальцинируют в течение 1 недели 10% водным раствором тетранатрий-ЭДТА при 4 ° С. Засоренные парафином срезы бедренной кости (толщиной 5 мкм) были приготовлены с помощью микротома и обработаны для гистологического наблюдения за метафизом под первичным спонгиозом путем окрашивания H&E и TRAP. Гистологические измерения и изображения были сделаны под микроскопом. Трабекулярная кость была обнаружена в срезах, окрашенных H & E, количество остеокластов было подсчитано в срезах с окрашиванием TRAP.

Биохимия сыворотки

Кровь собирали с помощью ретроорбитальной пункции, сыворотку - после центрифугирования при 4000 об/мин в течение 15 минут при 25 ° С. Уровни TRAP, TNF-α, IL-1β, IL-6, RANKL и OPG в сыворотке определяли с помощью набора для иммуноферментного анализа (ELISA) (BD Biosciences, Сан-Хосе, Калифорния, США) в соответствии с инструкциями производителя. Наборы для ELISA TRAP, TNF-α, IL-1 и IL-6 были получены от BD Biosciences (Сан-Хосе, Калифорния, США), наборы RANKL и OPG ELISA были от Boster (Ухань, Китай).

Клеточная культура и лечение

RAW264.7, мышиная моноцитарная клеточная линия, была получена из банка клеток Китайской академии наук (Шанхай, Китай) и содержалась в модифицированной по Дульбекко среде Игла (DMEM) с добавлением 10% инактивированной нагреванием фетальной бычьей сыворотки, стрептомицина (100 мг/мл) и пенициллина (100 ед/мл) в инкубаторе для культивирования клеток при 37 ° С и 5% СО 2

Мы выделили и культивировали первичные мононуклеарные клетки костного мозга (BMMCs) от мышей C57BL/6, как описано ранее (Guan et al., 2015). Для индукции образования остеокластов и BMMC, и RAW264.7 обрабатывали RANKL (50 нг/мл, R & D), и в культуральную среду BMMC также добавляли 25 нг/мл M-CSF (Guan et al., 2015). Культуральную среду меняли каждый день.

Анализ цитотоксичности

Клетки RAW264,7 (3 × 10 3 клеток/лунке) высевали в 96- луночные планшеты для анализа цитотоксичности. Через сутки клетки обрабатывали различными концентрациями таксифолина. Через 3 дня кривую LC 50 рассчитывали с помощью GraphPad Prism 5 в соответствии с результатами анализа цитотоксичности МТТ.

Окрашивание TRAP и анализ активности фермента TRAP

Для изучения влияния таксифолина на образование остеокластов в культивируемых BMMC и клетках RAW264.7, кроме RANKL (50 нг/мл) и / или M-CSF (25 нг/мл), клетки обрабатывали таксифолином/дигидрокверцетином  в указанных концентрациях в течение 4 дней. (Satue et al., 2013). Остеокласты идентифицировали с помощью набора для окрашивания устойчивой к тартрату кислой фосфатазы (TRAP) (Sigma-Aldrich) в соответствии с протоколом производителя. TRAP-положительные многоядерные клетки с тремя или более ядрами были идентифицированы как остеокласты (Asagiri and Takayanagi, 2007). 

Изображения клеток были получены с помощью цифровой камеры, подключенной к микроскопу EVOS FL Auto (Life Technologies, США). Активность фермента TRAP в культивируемой среде, собранной из BMMC, измеряли с помощью набора для анализа TRAP (Sigma-Aldrich, Шанхай, Китай), следуя инструкциям производителя. Активность фермента TRAP количественно определяли с использованием флуоресцентного планшет-ридера Synergy при длине волны 405 нм, на колориметрическом планшет-ридере.

Анализы формирования актинового кольца и окрашивание DAPI

Клетки RAW264.7 обрабатывали RANKL (50 нг/мл) и различными концентрациями таксифолина/дигидрокверцетина в течение 4 дней с образованием остеокластов. Затем в клетки добавляли фиксированный раствор для окрашивания иммунолом (Beyotime, Шанхай, Китай) в течение 10 минут. Затем клетки пермеабилизировали (изменяли проницаемость клеточных мембран) промывочным буфером для окрашивания иммунолом (Beyotime) в течение 5 минут ,и инкубировали с TRITC-фаллоидином (Sigma-Aldrich, St. Louis) , МО, США) при 25 ° С в течение 30 мин для визуализации F-актина. 

После обработки окрашиванием актиновым кольцом клетки промывали четыре раза физиологическим раствором с фосфатным буфером с последующим окрашиванием DAPI (Boster) в течение 5 минут. Изображения были получены с использованием флуоресцентного микроскопа.

Формирование участков резорбции остеокластами

Клетки RAW264.7 обрабатывали RANKL (50 нг/мл) в течение 4 дней с образованием остеокластов. Через 4 дня зрелые остеокласты собирали и высевали на поверхность для анализа Corning Osteo (Corning Incorporated Life Science, США) в многолуночный планшет в полной среде в присутствии RANKL (50 нг/мл) и различных концентраций таксифолина/дигидрокверцетина в течение 3 дней. Затем диски промывали 5% гипохлоритом натрия в течение 5 минут, и изображение резорбции  кости получали с помощью световой микроскопии, и площадь резорбции определяли количественно с помощью анализа изображений (BIOQUANT Image Analysis, Nashville, TN, United States).

Измерение продукции ROS

Клетки RAW264.7 культивировали на 12-луночных планшетах, после обработки таксифолином в течение 36 часов клетки инкубировали в течение 30 минут в присутствии RANKL (50 нг/мл). Впоследствии продукцию ROS измеряли проточной цитометрией с помощью набора для анализа ROS (Институт биотехнологии Beyotime, Цзянсу, Китай), как описано ранее (Zhao et al., 2018).

Количественная ПЦР с обратной транскрипцией в реальном времени (qRT-PCR)

Клетки RAW264.7 обрабатывали RANKL (50 нг/мл) в течение 3 дней, проводили qRT-ПЦР, как описано ранее (Zhao et al., 2018).  Тотальную клеточную РНК из культивируемых клеток RAW264.7 выделяли с помощью реагентов TRIzol (Invitrogen, Carlsbad, CA, United States). Первую цепь кДНК синтезировали из 2 мкг тотальной РНК с обратной транскриптазой MMLV (Promega, Madison, WI, United States). Шаблоны амплифицировали с помощью SYBR Green Master Mix (Invitrogen China Limited) на устройстве для ПЦР в реальном времени iCycler (Bio-Rad, CA, United States). 

Праймеры, синтезированные Invitrogen, были следующими (последовательности от 5 'до 3', смысловые и обратные): 

  • Rank : CAGGAGAGGCATTATGAGCA и GGTACTTTCCTGGTTCGCAT; 
  • Trap : GATGCCAGCGACAAGAGGTT и CATACCAGGGGATGTTGCGAA;
  •  Cathepsin K : GAAGAAGACTCACCAGAAGCAG и TCCAGGTTATGGGCAGAGATT; 
  • матриксная металлопротеиназа-9 ( Mmp-9 ): CTGGACAGCCAGACACTAAAG и CTCGCGGCAAGTCTTCAGAG; 
  • C-Fos : GGTGAAGAGCCGTGTCAGGAG и TATTCCGTTCCCTTCGGATT; 
  • Nfatc1 : CAACGCCCTGACCACCGATAG и GGGAAGTCAGAAGTGGGTGGA; 
  • GAPDH: ACCCAGAAGACTGTGGATGG и CACATTGGGGGTAG GAACAC.

Вестерн-блот анализ

Иммуноблот-анализ проводили в клетках RAW264.7, как описано (Guan et al., 2013 , 2015). Первичные антитела включали мышиный анти-GAPDH и анти-β-актин от Boster (Ухань, Китай). Клетки лизировали с использованием реагента для экстракции белка RIPA (Boster, Wuhan, China) с добавкой 1 мМ PMSF. Концентрацию белка определяли с использованием анализа BCA. Эквивалентное количество белка разделяли с помощью 10% геля SDS-PAGE и переносили на мембраны PVDF (Millipore, Billerica, MA, United States). 

Впоследствии мембраны были заблокированы и иммуноблотированы с индивидуальными антителами. Мембраны промывали и инкубировали с вторичными антителами, конъюгированными с пероксидазой хрена (Boster, Wuhan, China). Иммунореактивные белки визуализировали с использованием усиленной хемилюминесценции (Бостер, Ухань, Китай) и захватывали с помощью сканера (ChemiDoc MP, Bio-Rad, США).

Электрофоретический анализ сдвига подвижности (EMSA)

Анализ сдвига электрофоретической подвижности проводили, как описано ранее ( Guan et al., 2013 ; Zhao et al., 2017). ДНК-связывающую активность NF-κB и AP-1 детектировали с использованием набора хемилюминесцентного EMSA LightShift (Thermo Fisher Scientific, Китай). Клетки RAW264.7 предварительно обрабатывали таксифолином/дигидрокверцетином с концентрацией 100 мкМ в течение 2 часов и затем стимулировали 50 нг/мл RANKL в течение 30 минут. Ядерные экстракты готовили с использованием набора для экстракции ядерных и цитоплазматических белков (Институт биотехнологии Бейотайм, Цзянсу, Китай). С помощью набора LightShift Chemiluminescent EMSA (Thermo Fisher Scientific, Китай) равное количество ядерных экстрактов инкубировали с меченной биотином дуплексной ДНК и подвергали электрофорезу в 6% -ном полиакриламидном геле. Зонды AP-1 и NF-κB (Институт биотехнологии Beyotime, Цзянсу, Китай), используемые для EMSA, содержащие сайты распознавания консенсуса, были следующими: NF-κB, 5′-AGTTGAGGGGACTTTCCCAGGC-3′; AP-1, 5′-CGCTTGATGACTCAGCCGGAA-3′.

Статистический анализ

Эксперименты проводились не менее трех раз с аналогичными результатами. Данные были выражены как среднее значение ± стандартное отклонение. Студенческий т- тест использовался для сравнения двух групп. В случае сравнения, включающего более двух групп, использовался дисперсионный анализ (ANOVA). Статистическая значимость рассматривалась как  P <0,05, ∗∗ P<0,01, ∗∗∗ P <0,001.

Результаты: потеря костной массы и активность остеокластов у мышей OVX

Мы оценили влияние таксифолина/дигидрокверцетина на потерю костной массы с использованием модели мыши с овариэктомией. Как и ожидалось:

  • через 6 недель после операции (рис. 1 ) у мышей OVX наблюдалась значительная потеря трабекулярной кости, о чем свидетельствуют снижение МПК, объема губчатой ​​кости (BV / TV), толщины трабекулярной ткани (Tb.Th) и количества трабекулярной жидкости (Tb. N) и увеличенным трабекулярным пространством (Tb.Sp) по сравнению с ложнооперированными мышами. Срезы бедренной кости от мышей OVX продемонстрировали недостаток губчатой ​​кости как проксимальной, так и дистальной по отношению к ростовой пластинке. Трабекулы в обоих регионах скудные и тонкие;
  • обработка таксифолином у мышей OVX значительно ослабляла потерю трабекулярной кости, как показали параметры гистоморфометрии по сравнению с мышами OVX, получавшими носитель. Лечение таксифолином у мышей OVX вызывало заметное увеличение плотности кости со значительным увеличением толщины и плотности трабекулы по сравнению с мышами OVX, получавшими носитель. Эти секции группы OVX + таксифолин/дигидрокверцетин  были практически неотличимы от секций группы Sham + VEH.
  • результаты были дополнительно подтверждены декальцинированными H&E окрашенными срезами кости (рис ). 

Рисунок 1: Таксифолин/дигидрокверцетин  предотвращает потерю костной массы у овариэктомированных мышей. (A) Микро-КТ изображения трабекулярной кости вблизи дистальной области метафиза бедренной кости из репрезентативных образцов Sham + VEH (обработанные носителем контроли, имитирующие носитель), OVX + VEH (обработанные носителем мыши с овариэктомией) и OVX + таксифолин (дигидрокверцетин) обработанные овариэктомией мыши). Через шесть недель после операции трехмерную трабекулярную архитектуру изучали с использованием МККТ. Шкала баров, 1 мм. (B) Минеральная плотность кости (BMD) Значение костной ткани / общее значение (BV / TV), трабекулярное число (Tb.N), трабекулярное пространство (Tb.Sp) и трабекулярная толщина (Tb.Th) были проанализированы с помощью в программном обеспечении µCT, как описано в разделе «Материалы и методы» ( ∗ P <0,05, ∗∗ P<0,01, ∗∗∗ P <0,001 по сравнению с группой OVX, n = 12).

Рисунок 2: Таксифолин/дигидрокверцетин  уменьшает резорбцию кости и образование остеокластов у мышей OVX:

  • (А) типичное окрашивание гематоксилином и эозином (H & E) бедренных срезов из каждой группы через 6 недель после операции. Шкала баров, 400 мкм;
  • (B) Типичные окрашенные TRAP гистологические срезы бедренной кости длинной кости от ложных мышей, мышей OVX и мышей OVX + таксифолин для визуализации остеокластов TRAP + красного цвета. 20 × масштабные линейки, 200 мкм; увеличенные шкалы, 50 мкм;
  • (C) Количество остеокластов/поверхность кости определяли количественно;
  • (D) Сывороточные уровни OPG, RANKL, TRAP, IL-6, IL-1β и TNF-α определяли с помощью ELISA ( n = 12 на группу,  P <0,05, ∗∗ P<0,01, ∗∗∗ P <0,001).

Затем было исследована  дифференцировка остеокластов у мышей OVX, получавших таксифолин/дигидрокверцетин. По сравнению с мышами OVX, получавшими носитель, у мышей, получавших таксифолин, было обнаружено:

  • гораздо меньше окрашенных TRAP-положительных многоядерных клеток красного цвета на ростовых пластинах длинных костей (рис 2 в);
  • уменьшенное количество остеокластов на поверхность кости (N.Oc / BS) (рис 2 с );
  • снижение уровня TRAP в сыворотке, серологический маркер функции остеокластов ( рис 2 d). 

Эти наблюдения позволяют предположить, что таксифолин/дигидрокверцетин является сильным ингибитором остеокластогенеза и резорбционной активности. Таксифолин также эффективно снижал сывороточные уровни TNF-α, IL-6, IL-1β и RANKL и повышал сывороточный уровень OPG (рис 2 d).

Дифференцировка остеокластов и активность in vitro

Для дальнейшего изучения роли, которую играет таксифолин/дигидрокверцетин в остеокластогенезе, мы подтвердили его влияние на клетки RAW264.7 и BMMC. Кривая LC 50 была рассчитана с помощью GraphPad Prism 5 в соответствии с результатами анализа цитотоксичности МТТ для измерения цитотоксичности (рис. 3а). Обработка таксифолином значительно снижала количество TRAP-положительных многоядерных клеток дозозависимым образом (рис. 3 в-d ) с максимальным эффектом при концентрации 100 мкМ. Аналогичным образом, активность фермента TRAP в культуральной среде снижалась при обработке таксифолином (рис. 3 е).

Рисунок 3:

Таксифолин/дигидрокверцетин ингибирует дифференцировку и активность остеокластов in vitro :

  • (A)RAW264.7 и BMMC (культивируемые с M-CSF в концентрации 25 нг / мл) обрабатывали таксифолином различных концентраций. Через 3 дня для измерения цитотоксичности использовали кривую LC 50 ;
  •  (B – D) RAW264.7 и BMMC (культивируемые с M-CSF в концентрации 25 нг / мл) обрабатывали RANKL (50 нг / мл) и таксифолином различных концентраций в течение 4 дней, как указано на фигурах, клетки использовали для окрашивания TRAP и анализа активности фермента TRAP. Клетки TRAP + с тремя или более ядрами были идентифицированы как остеокласты;
  • (B) Таксифолин/дигидрокверцетин ингибирует образование остеокластов в зависимости от дозы. Шкала баров, 400 мкм.;
  • (CD)Количественное определение остеокластов, образованных RAW264.7 и BMMCs;
  • (E) Измеряли активность TRAP в культуральной среде BMMC. Данные представлены как среднее значение ± стандартное отклонение. n = 3,  P <0,05, ∗∗ P <0,01, ∗∗∗ P <0,001.

Остеокластическая Активность

Для дальнейшего изучения влияния таксифолина на активность остеокластов были проведены анализы образования актинового кольца и анализы резорбции костного среза. Результаты показали, что образование актинового кольца ингибировалось обработкой таксифолином (рис. 4а). Образовавшиеся остеокласты поднимали, высевали на срез кости и затем обрабатывали различными концентрациями таксифолина. Таксифолин сильно подавлял активность остеокластов по резорбции кости (рис. 4 в,с). Эти данные показали, что таксифолин нарушает функцию зрелых остеокластов.

Рисунок 4:

Таксифолин ингибирует функцию остеокластов:

  • (А) Таксифолин/дигидрокверцетин нарушил образование актинового кольца. Клетки RAW264.7 обрабатывали RANKL и с или без различных концентраций таксифолина, через 4 дня проводили окрашивание формирования актинового кольца и затем исследовали с помощью флуоресцентной микроскопии. Шкала баров, 400 мкм.;
  •  (B, C) Таксифолин ингибировал функцию резорбции кости остеокластом. Зрелые остеокласты собирали и высевали на поверхность для анализа Corning Osteo и обрабатывали с или без различных концентраций таксифолина в течение 3 дней. Изображения были взяты, и резорбция была определена количественно анализом изображения. Шкала баров, 400 мкм. Данные представлены как среднее значение ± стандартное отклонение. n = 3.  P<0.05, ∗∗P <0,01, ∗∗∗ P <0,001.

Экспрессия множества специфических генов и белков остеокластов

Чтобы исследовать механизмы ингибированного остеокластогенеза из клеток RAW264.7 с помощью таксифолина, мы измеряли экспрессию специфических генов остеокластов после обработки таксифолином. В остеокластах, полученных из клеток RAW264.7:

  • предварительная обработка таксифолином значительно ингибировала экспрессию мРНК Trap, Mmp-9, катепсина K, C-Fos, Nfatc1 и Rank (рис. 5а);
  • вестерн-блоты с использованием антител против MMP-9, TRAP, катепсина K, RANK, NFATc1 и C-Fos также продемонстрировали подавление этих специфических для остеокластов белков с помощью таксифолина из клеток RAW264.7 (рис. 5в);
  • ингибирование экспрессии маркеров остеокластов с помощью Taxifolin может быть связано с подавлением передачи сигналов RANKL.

Рисунок 5:

Таксифолин подавляет экспрессию генов и белков, специфичных для остеокластов. Клетки RAW264.7 обрабатывали RANKL и с или без различных концентраций таксифолина в течение 3 дней:

  • (А)экспрессию Trap, Mmp-9, катепсина K, C-Fos, Nfatc1 и ранга, определяли с помощью qRT-PCR и рассчитывали по отношению к мРНК GAPDH внутреннего контроля сравнительным методом Ct;
  • (B) иммуноблоты с антителами к MMP-9, TRAP, катепсину K, RANK, NFATc1 и C-Fos, демонстрируют, что таксифолин репрессирует остеокласт-специфическую экспрессию белка. Антитело к GAPDH использовали в качестве контролей загрузки;
  • (С) Клетки RAW264.7 культивировали с таксифолином в течение 36 часов, затем стимулировали RANKL (50 нг / мл) в течение 30 минут, и клетки RAW264.7 без RANKL или таксифолина считали «100% -ным контролем».

Наши результаты показали, что таксифолин уменьшал высвобождение внутриклеточных АФК. Данные представлены как среднее значение ± стандартное отклонение. n = 3,  P <0,05, ∗∗ P <0,01, ∗∗∗ P <0,001.

Выпуск внутриклеточных АФК

RANKL стимуляция повышает внутриклеточный уровень АФК, а АФК также активирует дифференцировку остеокластов. Мы измерили высвобождение внутриклеточной АФК, наши результаты показали, что продукция АФК была увеличена за счет стимуляции RANKL, но она была эффективно снижена таксифолином в зависимости от дозы (рис. 5с) .

Пути, участвующие в дифференцировке остеокластов

Мы также измерили активность основных молекулярных путей в клетках RAW264.7, обработанных таксифолином (рис. 6 а,в). Среди трех основных подсемейств MAPK уровни фосфорилированного p38 (p-P38), фосфорилированного ERK (p-ERK) и фосфорилированного JNK (p-JNK) демонстрировали выраженное увеличение при стимуляции RANKL, а лечение таксифолином полностью предотвращало их реакцию RANKL в зависимости от дозы и времени. Кроме того, таксифолин также ингибировал уровни фосфорилирования AKT (p-AKT), фосфорилирования IKKβ (p-IKKβ), фосфорилирования IkBα (p-IkBα) и фосфорилирования p65 (p-P65).

Рисунок 6:

Таксифолин/дигидрокверцетин  репрессирует множественные пути остеокластогенеза в клетках RAW264.7:

  • (А) Клетки RAW264.7 предварительно обрабатывали 100 мкМ таксифолина в течение 2 часов, затем стимулировали RANKL (50 нг / мл) в течение указанного времени, белок экстрагировали для иммуноблоттинга, тот же GAPDH использовали в качестве контроля загрузки;
  •  (B) Клетки RAW264.7 предварительно обрабатывали таксифолином в указанных концентрациях в течение 2 часов, затем стимулировали RANKL (50 нг / мл) в течение 15 минут, белок экстрагировали для иммуноблоттинга, тот же GAPDH использовали в качестве контроля нагрузки;
  • (С) Анализ сдвига электрофоретической подвижности ДНК-связывающей активности NF-κB и AP-1. После обработки 100 мкМ таксифолином/дигидрокверцетином в течение 2 ч клетки RAW264,7 стимулировали RANKL (50 нг / мл) в течение 30 мин, затем готовили ядерные экстракты и анализировали активность связывания ДНК. Данные трех независимых экспериментов.

ДНК-связывающая активность NF-κB и AP-1

Известно, что транскрипционные факторы, такие как NF-κB и AP-1, играют существенную роль в остеокластогенезе. Как показано (рис. 6с), через 30 минут после стимуляции RANKL ДНК-связывающая активность факторов транскрипции NF-κB и AP-1 заметно увеличилась. Сам по себе таксифолин не оказывал значительного влияния на исходную активность NF-κB и AP-1. Но надо принять во внимание, что лечение таксифолином/дигидрокверцетином значительно нарушало активацию NF-κB и AP-1 с помощью RANKL.

Обсуждение / ДИГИДРОКВЕРЦЕТИН И ЕГО ЭФФЕКТИВНОСТЬ ПРИ ОСТЕОПОРОЗЕ

В настоящем исследовании мы исследовали роль таксифолина/дигидрокверцетина в остеокластах Наше исследование in vivo продемонстрировало, что:

  • таксифолин эффективно защищает от изменений параметров костной архитектуры, маркеров сывороточного обмена костной ткани и провоспалительных цитокинов TNF-α и IL-1β;
  • что касается молекулярных механизмов, мы подтвердили, что множественные пути, включая NF-κB, MAPKs и AKT, нижестоящие пути RANKL, активированные во время остеокластогенеза, были значительно ингибированы таксифолином;
  • доказано, что флавоноиды защищают от потери костной массы, частично подавляя резорбцию остеокластов, стимулируя функцию остеобластов, уменьшая окислительный стресс или подавляя хроническое воспаление слабой степени ( Weaver et al., 2012 ; Welch and Hardcastle, 2014 );
  • мы исследовали, что NF-κB может быть одним из наиболее важных путей, которые опосредуют таксифолин остеокластогенеза. NF-κB является ключевым регулятором образования и функционирования остеокластов ( Takayanagi, 2007 );
  • сообщалось, что таксифолин стимулирует дифференцировку остеобластов в мезенхимальных стволовых клетках костного мозга, ингибируя индуцированную TNF-α активацию сигнального пути NF-κB ( Wang et al., 2017 ). Таксифолин/дигидрокверцетин  является своего рода фитоэстрогеном ( Jefferson et al., 2002), дефицит эстрогена способствует потере костной массы за счет увеличения выработки провоспалительных цитокинов при остеопорозе, вызванном дефицитом эстрогена ( Brincat et al., 2014 ). Некоторые воспалительные молекулы, такие как TNF-α, IL-1β и IL-6, могут косвенно стимулировать остеокластогенез и резорбцию кости путем увеличения экспрессии RANKL и M-CSF стромальными клетками и Т-клетками ( Lee et al., 2010), и провоспалительные цитокины, индуцированные остеокластогенезом, связаны с активацией NF-κB ( Jimi et al., 2004). Они намекают на то, что таксифолин/дигидрокверцетин  может подавлять остеокластогенез посредством пути NF-κB, вопреки тому, что мы ожидали, наши результаты показывают, что таксифолин ингибирует множественные нисходящие пути передачи сигналов RANK, включая NF-κB и MAPK. Более того, таксифолин может снижать сывороточные уровни RANKL, TNF-α, IL-1β и IL-6 у OVX-индуцирующих остеопенных мышей, что указывает на то, что таксифолин может также подавлять восходящие пути передачи сигналов RANK.

Предыдущие исследования ( Guo et al., 2015 ; Kuang et al., 2017 ; Xie et al., 2017) показали, что таксифолин/дигидро